4

I'm writing a lab report about gene sequencing, and I have to put a large sequence of nucleotides. I don't really intend to put it on a special box, just add it as if it were another paragraph only with the sequence. But when I compile is becomes a total disaster, LaTeX is unable to just break the sequence to next line, making a long single line text that overpasses the limit. I'm also using texttt in order to print it with monospaced font.

\texttt{
TAATAATCATATAGATTCCGTTCACCAAGGAA\textbf{ATG}TCTGGATCTCGCAAATTTTTTGTTGGGGGGAACTGGAAAATGAACGGAAGCAGAGATGACAACGATAAGTTACTTAAGTTACTCTCAGAAGCTCATTTTGATGATAACACGGAAGTTTTAATTGCTCCACCTTCAGTCTTTTTGCACGAAATTCGAAAAAGTTTGAAGAAAGAAATACACGTGGCCGCTCAAAATTGCTATAAAGTATCAAAGGGTGCATTCACCGGAGAAATCAGCCCAGCAATGATAAGAGATATTGGTTGTGATTGGGTCATACTTGGACATTCTGAGCGTAGAAACATTTTTGGTGAATCTGATGAACTTATTGCTGAAAAAGTTCAACATGCACTTGCTGAAGGTCTAAGCGTTATTGCATGTATTGGTGAAACATTATCAGAGCGTGAATCTAATAAAACAGAGGAAGTATGCGTTAGACAGTTAAAAGCTATTGCAAATAAGATTAAATCAGCTGATGAATGGAAACGAGTAGTCGTAGCATATGAACCAGTTTGGGCTATTGGAACAGGTAAAGTTGCTACACCACAACAAGCTCAAGAAGTTCATAATTTCCTTCGTAAATGGTTTAAAACGAATGCACCAAATGGAGTTGATGAAAAAATACGTATTATCTATGGTGGATCTGTAACTGCTGCCAATTGTAAAGAATTAGCTCAACAACATGATGTCGATGGATTTTTGGTTGGTGGAGCTTCATTAAAACCGGAATTCACTGAGATATGTAAAGCCAGACAACGT\textbf{TGA}ACGTTTTGTTGGTCTTCTTCTTCTTACGCTTCTAAATTTTGTCTCTTCTCATGTCAGTTACTTGCTTTTTTTGTCTTGTTTTTTTGTTTTGACAACCAAAGCATATTATAATTAGTAGTATCTTAATGTCTAATGTAAAAAAAAATATCACCACTAGTTCGAACTATTTAATTACTATCAGTCAAAAAAATAATATTTGTCAATTTAGTTCATTGTTTCATTTATCGTCCCTTCTATTTAAATTTCTTATGGCCTAAATATACCTTGAATTAATAAAAAAAAAAAA}

Last attempts resulted in Latex hyphenating gibberish, with textttt it just doesn't break the text at all. Also, I'm unable to make the text bold. Thanks for reading.

1
  • Welcome to TeX.SX! You should look at the seqsplit package.
    – egreg
    Commented Aug 15, 2015 at 20:52

2 Answers 2

4

The seqsplit package is exactly for this. In the example I use the Bera Mono font, because the default monospaced font doesn't have a boldface version.

\documentclass{article}
\usepackage[T1]{fontenc}
\usepackage{beramono}
\usepackage{seqsplit}

\begin{document}

\noindent\texttt{\seqsplit{%
  TAATAATCATATAGATTCCGTTCACCAAGGAA{\textbf{ATG}}TCTGGATCTCGCAAATTTTTTGTT%
  GGGGGGAACTGGAAAATGAACGGAAGCAGAGATGACAACGATAAGTTACTTAAGTTACTCTCAGAAGCTC%
  ATTTTGATGATAACACGGAAGTTTTAATTGCTCCACCTTCAGTCTTTTTGCACGAAATTCGAAAAAGTTT%
  GAAGAAAGAAATACACGTGGCCGCTCAAAATTGCTATAAAGTATCAAAGGGTGCATTCACCGGAGAAATC%
  AGCCCAGCAATGATAAGAGATATTGGTTGTGATTGGGTCATACTTGGACATTCTGAGCGTAGAAACATTT%
  TTGGTGAATCTGATGAACTTATTGCTGAAAAAGTTCAACATGCACTTGCTGAAGGTCTAAGCGTTATTGC%
  ATGTATTGGTGAAACATTATCAGAGCGTGAATCTAATAAAACAGAGGAAGTATGCGTTAGACAGTTAAAA%
  GCTATTGCAAATAAGATTAAATCAGCTGATGAATGGAAACGAGTAGTCGTAGCATATGAACCAGTTTGGG%
  CTATTGGAACAGGTAAAGTTGCTACACCACAACAAGCTCAAGAAGTTCATAATTTCCTTCGTAAATGGTT%
  TAAAACGAATGCACCAAATGGAGTTGATGAAAAAATACGTATTATCTATGGTGGATCTGTAACTGCTGCC%
  AATTGTAAAGAATTAGCTCAACAACATGATGTCGATGGATTTTTGGTTGGTGGAGCTTCATTAAAACCGG%
  AATTCACTGAGATATGTAAAGCCAGACAACGT\textbf{TGA}ACGTTTTGTTGGTCTTCTTCTTCTTA%
  CGCTTCTAAATTTTGTCTCTTCTCATGTCAGTTACTTGCTTTTTTTGTCTTGTTTTTTTGTTTTGACAAC%
  CAAAGCATATTATAATTAGTAGTATCTTAATGTCTAATGTAAAAAAAAATATCACCACTAGTTCGAACTA%
  TTTAATTACTATCAGTCAAAAAAATAATATTTGTCAATTTAGTTCATTGTTTCATTTATCGTCCCTTCTA%
  TTTAAATTTCTTATGGCCTAAATATACCTTGAATTAATAAAAAAAAAAAA}}

\end{document}

enter image description here

I would make a change in the definition of \seqsplit:

\documentclass{article}
\usepackage[T1]{fontenc}
\usepackage{beramono}
\usepackage{seqsplit}

\makeatletter
\renewcommand{\seqsplit}[2][\seqsplitdefaultfont]{%
  \begingroup
  #1% should be a font selection command
  \SQSPL@scan#2\SQSPL@end
  \endgroup
}
\makeatother
\newcommand{\seqsplitdefaultfont}{\ttfamily}% or whatever you prefer as default

\begin{document}

\noindent
\seqsplit{%
  TAATAATCATATAGATTCCGTTCACCAAGGAA{\textbf{ATG}}TCTGGATCTCGCAAATTTTTTGTT%
...

TTTAATTACTATCAGTCAAAAAAATAATATTTGTCAATTTAGTTCATTGTTTCATTTATCGTCCCTTCTA% TTTAAATTTCTTATGGCCTAAATATACCTTGAATTAATAAAAAAAAAAAA}

\end{document}

One can change the setup on the fly by typing, for instance,

\seqsplit[\ttfamily\bfseries]{...}

if in some case you want monospaced boldface for the whole sequence.

3
  • We had the same idea, but you were posting while I was finishing my example! I'll withdraw my post in a moment.
    – Bernard
    Commented Aug 15, 2015 at 21:04
  • @Bernard Maybe you can describe the solution with dnaseq
    – egreg
    Commented Aug 15, 2015 at 21:07
  • Having such theme for the first paper on LaTeX was a horrible idea. Hahahahaa. But thanks to your help I think it will look amazing. Thanks! Commented Aug 16, 2015 at 14:31
4

The seqsplit package is done for that. Here is a little demo of the possibilities (which probably have nothing to do with what you really need). If you don't know it you also might take a look at the dnaseq package. I also give a demo of it

\documentclass{article}
\usepackage[utf8]{inputenc}
\usepackage{lmodern}
\usepackage[showframe]{geometry}%
\usepackage{xcolor}
\usepackage{seqsplit, dnaseq}
\usepackage[default]{sourcecodepro}
% inconsolata
\begin{document}

\vspace*{1cm}
\noindent\seqsplit{\ttfamily%\ttfamily
\bgroup\itshape\bfseries TAA\egroup TAATCATATAGATTCCGTTCACCAAGGAAATGTCTGGATCTCGC{\color{red}AAA\color{black}}TTTTTTGTTGGGGGGAACTGGAAAATGAACGGAAGCAGAGATGACAACGATAAGTTACTTAAGTTACTCTCAGAAGCTCATTTTGATGATAACACGGAAGTTTTAATTGCTCCACCTTCAGTCTTTTTGCACGAAATTCGAAAAAGTTTGAAGAAAGAAATACACGTGGCCGCTCAAAATTGCTATAAAGTATCAAAGGGTGCATTCACCGGAGAAATCAGCCCAGCAATGATAAGAGATATTGGTTGTGATTGGGTCATACTTGGACATTCTGAGCGTAGAAACATTTTTGGTGAATCTGATGAACTTATTGCTGAAAAAGTTCAACATGCACTTGCTGAAGGTCTAAGCGTTATTGCATGTATTGGTGAAACATTATCAGAGCGTGAATCTAATAAAACAGAGGAAGTATGCGTTAGACAGTTAAAAGCTATTGCAAATAAGATTAAATCAGCTGATGAATGGAAACGAGTAGTCGTAGCATATGAACCAGTTTGGGCTATTGGAACAGGTAAAGTTGCTACACCACAACAAGCTCAAGAAGTTCATAATTTCCTTCGTAAATGGTTTAAAACGAATGCACCAAATGGAGTTGATGAAAAAATACGTATTATCTATGGTGGATCTGTAACTGCTGCCAATTGTAAAGAATTAGCTCAACAACATGATGTCGATGGATTTTTGGTTGGTGGAGCTTCATTAAAACCGGAATTCACTGAGATATGTAAAGCCAGACAACGT\textbf{TGA}ACGTTTTGTTGGTCTTCTTCTTCTTACGCTTCTAAATTTTGTCTCTTCTCATGTCAGTTACTTGCTTTTTTTGTCTTGTTTTTTTGTTTTGACAACCAAAGCATATTATAATTAGTAGTATCTTAATGTCTAATGTAAAAAAAAATATCACCACTAGTTCGAACTATTTAATTACTATCAGTCAAAAAAATAATATTTGTCAATTTAGTTCATTGTTTCATTTATCGTCCCTTCTATTTAAATTTCTTATGGCCTAAATATACCTTGAATTAATAAAAAAAAAAAA}

\vspace*{1cm}
\DNA ! TAATCATATAGATTCCGTTCACCAAGGAAATGTCTGGATCTCGC'{red}AAA'{white}TTTTTTGTTGGGGGGAACTGGAAAATGAACGGAAGCAGAGATGACAACGATAAGTTACTTAAGTTACTCTCAGAAGCTCATTTTGATGATAACACGGAAGTTTTAATTGCTCCACCTTCAGTCTTTTTGCACGAAATTCGAAAAAGTTTGAAGAAAGAAATACACGTGGCCGCTCAAAATTGCTATAAAGTATCAAAGGGTGCATTCACCGGAGAAATCAGCCCAGCAATGATAAGAGATATTGGTTGTGATTGGGTCATACTTGGACATTCTGAGCGTAGAAACATTTTTGGTGAATCTGATGAACTTATTGCTGAAAAAGTTCAACATGCACTTGCTGAAGGTCTAAGCGTTATTGCATGTATTGGTGAAACATTATCAGAGCGTGAATCTAATAAAACAGAGGAAGTATGCGTTAGACAGTTAAAAGCTATTGCAAATAAGATTAAATCAGCTGATGAATGGAAACGAGTAGTCGTAGCATATGAACCAGTTTGGGCTATTGGAACAGGTAAAGTTGCTACACCACAACAAGCTCAAGAAGTTCATAATTTCCTTCGTAAATGGTTTAAAACGAATGCACCAAATGGAGTTGATGAAAAAATACGTATTATCTATGGTGGATCTGTAACTGCTGCCAATTGTAAAGAATTAGCTCAACAACATGATGTCGATGGATTTTTGGTTGGTGGAGCTTCATTAAAACCGGAATTCACTGAGATATGTAAAGCCAGACAACGTTGAACGTTTTGTTGGTCTTCTTCTTCTTACGCTTCTAAATTTTGTCTCTTCTCATGTCAGTTACTTGCTTTTTTTGTCTTGTTTTTTTGTTTTGACAACCAAAGCATATTATAATTAGTAGTATCTTAATGTCTAATGTAAAAAAAAATATCACCACTAGTTCGAACTATTTAATTACTATCAGTCAAAAAAATAATATTTGTCAATTTAGTTCATTGTTTCATTTATCGTCCCTTCTATTTAAATTTCTTATGGCCTAAATATACCTTGAATTAATAAAAAAAAAAAA
! 

\end{document} 

enter image description here

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .