Table not appearing in document

Question

I've been having trouble getting a table to appear when I compile my document. Not sure whether it's a missing package or not defining the page width.

\documentclass[a4paper, 10pt]{article}
\usepackage[left=2cm, right=2cm, top=3cm, bottom=3cm]{geometry}
\usepackage{setspace} \onehalfspacing
\renewcommand{\rmdefault}{ptm} % Formatting
\usepackage{lipsum}
\usepackage{graphicx}
\graphicspath{ {Figures/} }
\usepackage{mathptmx} % Times math font
\usepackage{mciteplus} % Bibliography preferences
\usepackage{rsc} 
\usepackage[nottoc,notlof,notlot]{tocbibind} 
\renewcommand\bibname{references}
\usepackage[font=small, labelfont=bf]{caption}
\usepackage{esdiff}
\usepackage{amsmath}
\setlength\parindent{1.0cm}
\usepackage{subfigure}
\usepackage[export]{adjustbox}
\usepackage{titlesec}
\usepackage{tabularx}
\usepackage{url}
\usepackage{multicol}

Here is the table I would like to make work

\begin{table}[b]
    \caption{List of sequences} 
    \label{sequences}\ centering
    \centering
    \begin{tabular}[t]{c c c}
        \hline\hline \\ [-1.5ex]
        Experiment & Strand & Sequence \\ [0.5ex]
        \hline \\ [-1.5ex]
        Bulk & Q & "TTGCTAGGTCTCGCTATGAGGATCTAT"  \\ [0.5ex]
        Vesicles & B & “GTGTTGAGTAGTGAGATGTTTTTTTAGCGAGACCTAGCAATTGAAGTGGAGAAGAGC” \\ [0.5ex]
        \hline
    \end{tabular}
\end{table}

Let me know if you have any suggestions. I'm quite new to this, so apologies if it's quite a simple problem.

Edit: It seems to be a problem with the multicol package which does not allow floats and marginpars? Here is an example doc in which it does not seem to display.

\documentclass[a4paper, 10pt]{article}
\usepackage[left=2cm, right=2cm, top=3cm, bottom=3cm]{geometry}
\usepackage{setspace} \onehalfspacing
\renewcommand{\rmdefault}{ptm} % Formatting
\usepackage{lipsum}
\usepackage{graphicx}
\graphicspath{ {Figures/} }
\usepackage{mathptmx} % Times math font
\usepackage{mciteplus} % Bibliography preferences
\usepackage{rsc} 
\usepackage[nottoc,notlof,notlot]{tocbibind} 
\renewcommand\bibname{references}
\usepackage[font=small, labelfont=bf]{caption}
\usepackage{esdiff}
\usepackage{amsmath}
\setlength\parindent{1.0cm}
\usepackage{subfigure}
\usepackage[export]{adjustbox}
\usepackage{titlesec}
\usepackage{tabularx}
\usepackage{url}
\usepackage{multicol}

\titleformat{\chapter}[block]
  {\normalfont\huge\bfseries}{\thechapter}{20pt}{}
\titlespacing*{\chapter}
  {0pt}{20pt}{20pt}

\titleformat{\subsubsection}
  {\itshape\normalsize}{\thesubsubsection}{1em}{}

\setcounter{secnumdepth}{3}
\setcounter{tocdepth}{3}

%trim={<left> <lower> <right> <upper>}

\title{Mini 1 project}
\author{JoshuaT31524}
\date{\today}

\begin{document}


\maketitle

    \begin{abstract}

 Insert amazing abstract here. 


    \end{abstract}

\section*{Acknowledgements}
Many thanks to my supervisor, etc

\begin{multicols}{2}

\subsection{Preparation of unilamellar vesicles by extrusion}

200 $\mu$L of 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) was placed in a vacuum desiccator for 1 h before being reconsituted in 500 $\mu$L of sucrose. The lipid solution was then freeze-thawed four times in liquid nitrogen and extruded through a 1 $\mu$m membrane multiple times to yield the vesicles suspended in sucrose.  

\begin{table}[b]
    \caption{A table displaying the sequences for the strands which make up the DNA receptors for both the bulk and vesicle experiments} 
    \label{sequences}\centering
    \centering
    \begin{tabular}[t]{c c c}
        \hline\hline \\ [-1.5ex]
        Experiment & Strand & Sequence \\ [0.5ex]
        \hline \\ [-1.5ex]
        Bulk & Q & "TTGCTAGGTCTCGCTATGAGGATCTAT"  \\ [0.5ex]
        Vesicles & B & “GTGTTGAGTAGTGAGATGTTTTTTTAGCGAGACCTAGCAATTGAAGTGGAGAAGAGC” \\ [0.5ex]
        \hline
    \end{tabular}
\end{table}

\end{multicols}
\end{document}

Answer 1

Just use environment table* to get on the next page a table over both/all columns. In the following MWE I added command \lipsum to get some blind text.

With the following MWE (see <====== for important code changings)

\documentclass[a4paper, 10pt]{article}
\usepackage[left=2cm, right=2cm, top=3cm, bottom=3cm]{geometry}
\usepackage{setspace} \onehalfspacing
\renewcommand{\rmdefault}{ptm} % Formatting
\usepackage{lipsum}
\usepackage{graphicx}
\graphicspath{ {Figures/} }
\usepackage{mathptmx} % Times math font
\usepackage{mciteplus} % Bibliography preferences
\usepackage{rsc} 
\usepackage[nottoc,notlof,notlot]{tocbibind} 
\renewcommand\bibname{references}
\usepackage[font=small, labelfont=bf]{caption}
\usepackage{esdiff}
\usepackage{amsmath}
\setlength\parindent{1.0cm}
%\usepackage{subfigure} % outdated
\usepackage[export]{adjustbox}
\usepackage{titlesec}
\usepackage{tabularx}
\usepackage{url}
\usepackage{multicol}

\titleformat{\chapter}[block]
  {\normalfont\huge\bfseries}{\thechapter}{20pt}{}
\titlespacing*{\chapter}
  {0pt}{20pt}{20pt}

\titleformat{\subsubsection}
  {\itshape\normalsize}{\thesubsubsection}{1em}{}

\setcounter{secnumdepth}{3}
\setcounter{tocdepth}{3}

%trim={<left> <lower> <right> <upper>}

\title{Mini 1 project}
\author{JoshuaT31524}
\date{\today}

\begin{document}


\maketitle

    \begin{abstract}

 Insert amazing abstract here. 


    \end{abstract}

\section*{Acknowledgements}
Many thanks to my supervisor, etc

\begin{multicols}{2}

\subsection{Preparation of unilamellar vesicles by extrusion}

200 $\mu$L of 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) was placed 
in a vacuum desiccator for 1 h before being reconsituted in 500 $\mu$L 
of sucrose. The lipid solution was then freeze-thawed four times in 
liquid nitrogen and extruded through a 1 $\mu$m membrane multiple times 
to yield the vesicles suspended in sucrose.  

\lipsum[1-4] % <========================================================

\begin{table*}[b] % t for top also possible <===========================
    \caption{A table displaying the sequences for the strands which make up the DNA receptors for both the bulk and vesicle experiments} 
    \label{sequences}\centering
    \centering
    \begin{tabular}[t]{c c c}
        \hline\hline \\ [-1.5ex]
        Experiment & Strand & Sequence \\ [0.5ex]
        \hline \\ [-1.5ex]
        Bulk & Q & "TTGCTAGGTCTCGCTATGAGGATCTAT"  \\ [0.5ex]
        Vesicles & B & “GTGTTGAGTAGTGAGATGTTTTTTTAGCGAGACCTAGCAATTGAAGTGGAGAAGAGC” \\ [0.5ex]
        \hline
    \end{tabular}
\end{table*} % <========================================================

\lipsum[5-11] % <=======================================================

\end{multicols}
\end{document}

you get the following second page: