Weird spacing between caption and table with floatrow package

Question

What I would like to do : put table captions directly above my tables without space between the caption and the table

Here is what I get :

I am using the floatrow, subfig and caption package and I am writing in the report class

What I don't understand :

• Why my table captions are by default below the tables ? I thought Latex usually put table captions above ? So I have to specify it with the floatrow package by \floatstyle[table]{capposition=top} However, with the caption package, the command \captionsetup[table]{position=above} does not seem to work.

• Why can not I remove the space between caption and table ? with the floatrow package, the command \floatstyle[table]{captionskip=0pt}seems to have an impact but not as expected whereas with the caption package, it does not work (\captionsetup[table]{skip=0pt}).

Is there any package conflicts I am not aware of ?

Here is a simplified code with truncated tables :

\documentclass[12pt,a4paper,oneside]{report}
\usepackage[top=2.5cm, bottom=2.5cm, left=2.5cm, right=2.5cm]{geometry}
\usepackage{graphicx}
\usepackage{setspace}
\usepackage[utf8]{inputenc}
\usepackage{floatrow}
\usepackage{multirow,bigdelim}
\usepackage{booktabs}
\usepackage{textgreek}
\usepackage{gensymb}
\usepackage[label font=bf,labelformat=simple]{subfig}%using for my other figures
\usepackage[font=footnotesize,labelfont=bf]{caption}%also using for my other figures
    \floatsetup[table]{capposition=top,captionskip=0pt}
\usepackage[table]{xcolor}
    \definecolor{GrayTable}{gray}{0.90}
    \definecolor{GrayText}{gray}{0.55}
    \definecolor{BlueTable}{rgb}{0.0,0.6,0.9}

\begin{document}

\begin{table}[!htb]
    \caption{Mix PCR pour vérifier la présence des LCT}
    \rowcolors{2}{GrayTable}{white}
    \resizebox{\textwidth}{!}{% Using this command because the table is large
    \begin{tabular}{ccccc}
    \toprule
    \rowcolor{BlueTable} LCT & Séquence SU & Taille de l'amplicon (pb) & Température d'hybridation (\degree C) & Concentration en MgCl$_{2}$ \\
    \midrule
LCT\_0071   &   AAAAGAGCGTGTTATTTTAGGCA &   200 &   60  &   2   \\
LCT\_0078   &   TGGCCACCTTCTCTTTCCAT    &   143 &   60  &   2   \\
LCT\_0090   &   ACGGCTTTGCTTTCAGTTGT    &   160 &   60  &   2   \\
    \bottomrule
    \end{tabular}}
\end{table}

\begin{table}[!htb]
    \singlespacing
    \caption{Mix PCR pour vérifier la présence des LCT}
    \begin{tabular}{ccccc}
    \toprule
    \rowcolor{BlueTable} Réactifs & Concentration initiale & Concentration finale & Volume pour 1 tube (\textmu L)  \\
    \midrule
    Buffer & 5X & 1X & 5\\
    \bottomrule
    \end{tabular}
\end{table}

\end{document}

Thanks !

Answer 1

The large space between the caption and the second table is caused by the singlespacing command. If you remove this, you will get the following output:

---

Personally, I'd redesign your tables as follows:

a) Usage of mhchem for easier input of chemical formulae

b) Usage of siunitx for units (By the way: The unit for the concentration in the first table is missing)

c) Removing all color as usage of color does not enhance the readability of the tables

d) Removing the \resizebox command from the first table. Replaced long table headers with appropriate abbreviations that are explained below the table.

Thouse changes will result in the following output:

Corrensponding MWE:

\documentclass[12pt,a4paper,oneside]{report}
\usepackage[top=2.5cm, bottom=2.5cm, left=2.5cm, right=2.5cm]{geometry}
\usepackage[utf8]{inputenc}
\usepackage{floatrow}
\usepackage{booktabs}

\usepackage[label font=bf,labelformat=simple]{subfig}%using for my other figures
\usepackage[font=footnotesize,labelfont=bf]{caption}%also using for my other figures
    \floatsetup[table]{capposition=top,captionskip=0pt}

\usepackage[version=4]{mhchem}
\usepackage{makecell}
\usepackage{tabularx}
\usepackage{siunitx}

\begin{document}

\begin{table}[!htb]
    \caption{Mix PCR pour vérifier la présence des LCT}
    \begin{tabular}{ccccc}
    \toprule
     LCT & Séquence SU & l(ampl.) & T(hybrid.) & c(\ce{MgCl2}) \\
    \midrule
LCT\_0071   &   AAAAGAGCGTGTTATTTTAGGCA &   200 &   60  &   2   \\
LCT\_0078   &   TGGCCACCTTCTCTTTCCAT    &   143 &   60  &   2   \\
LCT\_0090   &   ACGGCTTTGCTTTCAGTTGT    &   160 &   60  &   2   \\
    \bottomrule
    \multicolumn{5}{l}{l(ampl.) = Taille de  l'amplicon (pb)}\\
    \multicolumn{5}{l}{T(hybrid.) = Température d'hybridation (\si{\celsius})}\\
    \multicolumn{5}{l}{c(\ce{MgCl2}) = Concentration en \ce{MgCl2}}
    \end{tabular}
\end{table}

\begin{table}[!htb]
    %\singlespacing
    \caption{Mix PCR pour vérifier la présence des LCT}
    \begin{tabular}{ccccc}
    \toprule
     Réactifs & \multicolumn{2}{c}{Concentration}  & Volume pour 1 tube (\si{\micro\liter})  \\
     \cmidrule{2-3}
     & initiale &  finale \\
    \midrule
    Buffer & 5X & 1X & 5\\
    \bottomrule
    \end{tabular}
\end{table}

\end{document}